­
­
­
­

Inventi Impact - Oncology
(Formerly Inventi Rapid/Impact: Cancer)

Patent Watch

  • Method of use of nitrogen gas in the treatment of cancer and obesity

    The method of the invention is directed at the injection of nitrogen gas into a tumor or fatty tissue mass previously made hypoxic/anoxic by obtunding its blood supply in order to facilitate the uptake of said nitrogen into the mitochondria of said tissues, where it becomes trapped and blocks oxygen re-uptake leading to mitochondrial apoptosis and death of local cells and tissue.

  • Method of use of nitrogen gas in the treatment of cancer and obesity

    The method of the invention is directed at the injection of nitrogen gas into a tumor or fatty tissue mass previously made hypoxic/anoxic by obtunding its blood supply in order to facilitate the uptake of said nitrogen into the mitochondria of said tissues, where it becomes trapped and blocks oxygen re-uptake leading to mitochondrial apoptosis and death of local cells and tissue.

  • POTENTIATION OF ANTI-CANCER ACTIVITY THROUGH COMBINATION THERAPY WITH BER PATHWAY INHIBITORS

    Provided herein are pharmaceutical compositions and methods of treating cancer wherein the cytotoxic activity of an anticancer agent is potentiated by the combination of base excision repair (BER) pathway inhibitors.

  • COMPOSITIONS AND METHODS FOR THE TREATMENT OF CANCER

    The present invention relates to compositions, kits, and methods for treatment of cancers. In some cases, the composition comprises a platinum compound comprising a phenanthridine ligand.

  • COMBINATION OF LBH589 WITH OTHER THERAPEUTIC AGENTS FOR TREATING CANCER

    The invention relates to a combination comprising the N-hydroxy-3-[4-[[[2-(2-methyl-1H-indol-3-yl)-ethyl]-amino]methyl]phenyl]-- 2E-2-propenamide; and one or more pharmaceutically active agents; pharmaceutical compositions comprising said combination; methods of treatment comprising said combination; processes for making said combination; and a commercial package comprising said combination.

  • COMPOSITIONS AND METHODS FOR DETERMING CANCER SUSCEPTIBILITY

    The invention generally relates to a molecular classification of disease and particularly to molecular markers for cancer susceptibility and methods of use thereof. More specifically, the invention relates to the determination, screening, or classification of an individual's genetic risk for breast and ovarian cancer susceptibility.

  • Method for Preventing Cancer Metastasis

    The present invention relates to the use of a specific family of glycerolipid compounds of formula (I) described in the detailed description or the manufacture of a medicament for the prevention or for the treatment of cancer metastasis.

  • METHOD OF TREATING PROSTATE CANCER WITH GnRH ANTAGONIST

    The invention provides methods and dosing regimens for safely and effectively treating androgen-dependent prostate cancer with a gonadotrophin releasing hormone (GnRH) antagonist without causing a testosterone spike and/or other side effect of GnRH agonist therapy such as a urinary tract infection, or an arthralgia-related or cardiovascular side effect. The present disclosure also provides for methods for treating prostate cancer in a patient with a history of at least one cardiovascular event, wherein administration of degarelix to the subject decreases the likelihood of developing or experiencing an additional cardiovascular event compared to treatment with a gonadotrophin releasing hormone (GnRH) agonist.

  • TREATMENT OF CANCER

    Provided are methods relating to compositions that include a CDP-topoisomerase inhibitor, e.g., a CDP-camptothecin or camptothecin derivative conjugate, e.g., CRLX101.

  • MICRORNA MARKERS FOR RECURRENCE OF COLORECTAL CANCER

    The present invention concerns methods and compositions for identifying a miRNA profile for a particular condition, such as colorectal cancer, and using the profile in the diagnosis and/or prognosis of a patient for a condition, such as colorectal cancer and colorectal cancer recurrence or response to therapy.

  • METHODS AND KITS FOR THE DETECTION OF CANCER INFILTRATION OF THE CENTRAL NERVOUS SYSTEM

    This invention relates to methods to detect the presence of cancer infiltration of the Central Nervous System (CNS) based on the detection of soluble proteins, preferably, in cerebrospinal fluid samples and vitreous fluid. The invention also relates to kits to perform the methods of the invention.

  • Methods Of Diagnosing Or Treating Prostate Cancer Using The ERG Gene, Alone Or In Combination With Other Over Or Under Expressed Genes In Prostate Cancer

    The present invention relates to oncogenes or tumor suppressor genes, as well as other genes, involved in prostate cancer and their expression products, as well as derivatives and analogs thereof. Provided are therapeutic compositions and methods of detecting and treating cancer, including prostate and other related cancers. Also provided are methods of diagnosing and/or prognosing prostate cancer by determining the expression level of at least one prostate cancer-cell-specific gene, including, for example, the ERG gene or the LTF gene alone, or in combination with at least one of the AMACR gene and the DD3 gene.

  • DENDRITIC CELL (DC)-VACCINE THERAPY FOR PANCREATIC CANCER

    Compositions and methods for eliciting therapeutic immunity and improving clinical outcomes in patients with pancreatic cancer are disclosed herein. The present invention describes a dendritic cell (DC)-vaccine comprising DCs pulsed with peptides derived from pancreatic cancer antigens for the therapy against pancreatic cancer. The vaccine described herein is safe, and leads to expansion of cancer specific T cells in patients with pancreatic cancer.

  • NOVEL METHODS FOR TARGETING CANCER STEM CELLS

    The invention provides naphthofuran compounds, polymorphs of naphthofuran compounds, naphthofuran compounds in particle form, purified compositions that contain one or more naphthofuran compounds, purified compositions that contain one or more naphthofuran compounds in particle form, methods of producing these naphthofuran compounds, polymorphs, purified compositions and/or particle forms, and methods of using these naphthofuran compounds, polymorphs, purified compositions and/or particle forms to treat subjects in need thereof.

  • METHOD FOR PREDICTING THERAPEUTIC EFFECT OF IMMUNOTHERAPY ON CANCER PATIENT AND/OR PROGNOSIS AFTER IMMUNOTHERAPY, AND GENE SET AND KIT TO BE USED THERIN

    The present invention provides a method for predicting effect of immunotherapy on a cancer patient and/or prognosis of the cancer patient after the immunotherapy, and a gene set and a kit for use in the method.

  • Adenovirus E1A Fragments for Use in Anti-Cancer Therapies

    The present invention relates to an improved cancer therapy comprising co-administration with the E1A 1-80 transcription-repression domain activity. In addition, E1A 1-80 can act as a monotherapy against cancers that express elevated HER2/Neu or in combination with anti-HER2/Neu, chemo- or radiotherapeutic treatments.

  • 3.4kb MITOCHONDRIAL DNA DELETION FOR USE IN THE DETECTION OF CANCER

    The present invention broadly claims a method for detecting cancer in an individual. The method comprises detecting a deletion in the nucleic acid sequence between residues 10743 and 12125 in mitochondrial DNA. The method comprises obtaining a biological sample from the individual; extracting the mitochondrial DNA (mtDNA) from the sample; quantifying the amount of mtDNA in the sample having a deletion in the nucleic acid sequence between residues 10743 and 14125 of the mtDNA genome; and comparing the amount of mtDNA in the sample having the deletion to at least one known reference sample.

  • IgE ANTIBODIES FOR THE TREATMENT OF CANCER

    The present invention provides monoclonal IgE antibodies comprising Fc epsilon (.epsilon.) constant regions and variable regions comprising at least one antigen binding region specific for binding a single epitope of a circulating, tumor-associated antigen (TAA) that is not a cell surface antigen wherein the epitope of the targeted antigen is not highly repetitive or is a non-repetitive epitope. The IgE antibodies of the invention are useful in the treatment of cancer associated with the tumor antigen. In one embodiment the TAA is prostate-specific antigen (PSA).

  • TREATMENT OF CANCER WITH BIO AND CHEMOTHERAPY

    This invention relates to compositions and methods utilizing a chemotherapeutic drug and 6-bromoindirubin3'-oxime (BIO) for the treatment of cancer, including glioblastoma multiforme. The present invention demonstrates that BIO works synergistically with chemotherapeutic drugs to increase the cytotoxic effects of these drugs in glioma cells.

  • CAMALEXIN AS A TREATMENT FOR PROSTATE CANCER

    Compositions and methods to treat prostate cancer with the compound camalexin and its structural analogs. Camalexin increases ROS production and decreases the proliferation of prostate cancer cells, especially aggressive prostate cancer cells.

  • APOPTOSIS-INDUCING AGENTS FOR THE TREATMENT OF CANCER AND IMMUNE AND AUTOIMMUNE DISEASES

    Disclosed are compounds which inhibit the activity of anti-apoptotic Bc1-xL proteins, compositions containing the compounds and methods of treating diseases during which is expressed anti-apoptotic Bc1-xL protein.

  • METHOD OF TREATING BRAIN CANCER

    A therapeutic method for treating brain cancer is disclosed comprising administering to a patient in need of treatment a ruthenium complex salt.

  • TRANSITION METAL COMPLEXES OF AMINO ACIDS AND RELATED LIGANDS AND THEIR USE AS CATALYSTS, ANTI-MICROBIALS, AND ANTI-CANCERAGENTS

    The present invention relates to the fields of chemistry and pharmaceuticals. Embodiments of the present invention provide transition metal complexes of amino acids. Transition metal complexes of embodiments of the invention according to Categories I, II, III, and/or IV may be used as antimicrobial, anti-malarial, and anti-cancer agents, as well as catalysts in chemical reactions. Such compounds of the invention are particularly useful for combating multi-drug resistance against a broad range of microbials (such as MRSA and mycobacteria), including gram positive and gram negative bacteria, as well as can be used as anti-cancer agents against bladder cancer, breast cancer, colon cancer, rectal cancer, endometrial cancer, kidney cancer, leukemia, lung cancer, melanoma, non-Hodgkin's lymphoma, pancreatic cancer, prostate cancer, and thyroid cancer, to name a few.

  • Agonists of Guanylate Cyclase Useful For the Treatment of Gastrointestinal Disorders, Inflammation, Cancer and Other Disorders

    The invention provides novel guanylate cyclase-C agonist peptides and their use in the treatment of human diseases including gastrointestinal disorders, inflammation or cancer (e.g., a gastrointestinal cancer). The peptides can be administered either alone or in combination with an inhibitor of cGMP-dependent phosphodiesterase. The gastrointestinal disorder may be classified as either irritable bowel syndrome, constipation, or excessive acidity etc. The gastrointestinal disease may be classified as either inflammatory bowel disease or other GI condition including Crohn's disease and ulcerative colitis, and cancer.

  • Methods and Materials Related to Ovarian Cancer

    Described herein are methods for diagnosing ovarian cancer. In particular, certain microRNAs are useful to the response to chemotherapy of ovarian cancer patients.

  • RECURRENT GENE FUSIONS IN BREAST CANCER

    The present disclosure relates to compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present disclosure relates to gene fusions as diagnostic markers and clinical targets for breast cancer.

  • METHOD FOR DIFFERENTIALLY QUANTIFYING NATURALLY PROCESSED HLA-RESTRICTED PEPTIDES FOR CANCER, AUTOIMMUNE AND INFECTIOUS DISEASES IMMUNOTHERAPY DEVELOPMENT

    The invention relates to a method for quantitatively identifying relevant HLA-bound peptide antigens from primary tissue specimens on a large scale without labeling approaches. This method can not only be used for the development of peptide vaccines, but is also highly valuable for a molecularly defined immunomonitoring and the identification of new antigens for any immunotherapeutic strategy in which HLA-restricted antigenic determinants function as targets, such as a variety of subunit vaccines or adoptive T-cell transfer approaches in cancer, or infectious and autoimmune diseases.

  • METHOD FOR DETECTION OF UROTHELIAL CANCER

    It is to provide a method for detecting urothelial cancer simply and with high accuracy. It is a method for detecting urothelial cancer comprising administering 5-aminolevulinic acid (ALA), a derivative thereof, or a salt of these to a test subject, collecting urine from the test subject, and detecting the presence of fluorescence or amount of fluorescence in the collected urine.

  • SERUM SPLA2-IIA AS DIAGNOSIS MARKER FOR PROSTATE AND LUNG CANCER

    Kits for assessing lung cancer in patients with solitary pulmonary nodules and methods for assessing lung cancer. The kit includes reagents for detection and/or quantification of serum secretory phospholipase A.sub.2-IIA in plasma, reagents for detection and/or quantification of carcinoembryonic antigen in plasma, and reagents for detection and/or quantification of cytokeratin-19 fragment in plasma. The method includes contacting a sample with a specific binding agent for serum secretory phospholipase A.sub.2-IIA, a specific binding agent for carcinoembryonic antigen, and a specific binding agent for cytokeratin-19 fragment, calculating levels of serum secretory phospholipase A.sub.2-IIA, carcinoembryonic antigen, and cytokeratin-19 fragment, and assessing as indicating lung cancer in the patient if the calculated levels are elevated.

  • COMPOSITION FOR DIAGNOSIS OF LUNG CANCER AND DIAGNOSIS KIT OF LUNG CANCER

    Disclosed is as a biomarker useful in early diagnosis of lung cancer, at least one protein selected from the group including Quescin-sulfhydryl oxidase 1, Fibrillin-1, Isoform A of Lamin-A/C, Latent-transforming growth factor beta-binding protein 2, Galectin-1, highly similar to Dickkopf-related protein 3, Isoform Al--B of Heterogeneous nuclear ribonucleoprotein Al, 14-3-3 protein epsilon, Stanniocalcin-2, Cystatin-C, Isoform 1 of Connective tissue growth factor, Profilin-1, Isoform 1 of Extracellular matrix protein 1, Histone H2B type 2-E, Kinesin-like protein KIF26A, Zinc finger protein 516, and Isoform 1 of A-kinase anchor protein 9.

  • PREDICTIVE BIOMARKERS FOR BREAST CANCER

    The invention relates to compositions and methods for detecting, screening, diagnosing or determining the progression of, regression of and/or survival from a proliferative disease or condition, specifically breast cancer. The invention also provides new assays and kits for the staging or stratifying breast cancer patients or patients suspected of having breast cancer.

  • METHODS FOR DIAGNOSIS OF COLORECTAL CANCER

    Methods and systems for use of phenotypic markers, principally oral mucosal vascular density alone or in combination with detection of other markers, to identify individuals afflicted with or having an increased risk of hereditary colorectal cancer, especially familial adenomatous polyposis, are disclosed.

  • POTENTIATOR OF ACTIVITY OF ANTI-CANCER AGENT AND USE THEREOF, AND BIOMARKER FOR PREDICTION OF PROGNOSIS IN CANCER PATIENT AND USE THEREOF

    Disclosed is a means for improving the clinical outcomes of cancer therapy. Specifically disclosed is an activity potentiator comprising a compound capable of inhibiting the expression of RFP (RET finger protein) gene or the activity of RFP as an active ingredient. The activity of an anti-cancer agent having an oxidative stress inducing ability can be potentiated by using the anti-cancer agent in combination with the activity potentiator. Further specifically disclosed are a biomarker useful for the recognition of prognosis in a cancer patient and use of the biomarker.

  • METHOD FOR PREDICTING THERAPEUTIC EFFECT OF IMMUNOTHERAPY ON CANCER PATIENT, AND GENE SET AND KIT TO BE USED IN THE METHOD

    Provided is a gene set which is useful for predicting the therapeutic effect of an immunotherapy on a cancer patient. Also provided is a method for examining whether an immunotherapy is efficacious or not, said method comprising quantifying the expression amount of each of the genes constituting the aforesaid gene set. This examination method is useful for determining a therapeutic strategy for the cancer patient.

  • Method for Treating Oncological Diseases

    A method to treat solid tumors and other oncological diseases consists of parenterally injecting an agent which destroy's blood's extracellular DNA into the systemic blood circulation of a cancer patient to slow down malignant. The agent is embodied in the form of a DNAse enzyme and, more particularly, as a bovine pancreatic DNAse. Doses from 50,000-250,000,000 Kunz units/day are injected for 5-360 days. A binding agent or an agent that modifies the chemical composition of the blood extracellular DNA is additionally injected into the blood. This modifying agent is preferably an enzyme-ribonuclease.

  • BIOLOGICAL MARKERS PREDICTIVE OF ANTI-CANCER RESPONSE TO KINASE INHIBITORS

    The present invention provides diagnostic and prognostic methods for predicting the effectiveness of treatment of a cancer patient with inhibitors of EGFR kinase, PDGFR kinase, or FGFR kinase. Based on the surprising discovery that tumors cells after having undergone an EMT, while being mesenchymal-like, still express characteristics of both epithelial and mesenchymal cells, and that such cells have altered sensitivity to inhibition by receptor protein-tyrosine kinase inhibitors, in that they have become relatively insensitive to EGFR kinase inhibitors, but have frequently acquired sensitivity to inhibitors of other receptor protein-tyrosine kinases such as PDGFR or FGFR, methods have been devised for determining levels of specific epithelial and mesenchymal biomarkers that identify such "hybrid" tumor cells (e.g. determination of co-expression of vimentin and epithelial keratins), and thus predict the tumor's likely sensitivity to inhibitors of EGFR kinase, PDGFR kinase, or FGFR kinase. Improved methods for treating cancer patients with EGFR, PDGFR or FGFR kinase inhibitors that incorporate such methodology are also provided.

  • Gene Expression Profile Algorithm and Test for Determining Prognosis of Prostate Cancer

    The present invention provides algorithm-based molecular assays that involve measurement of expression levels of genes, or their co-expressed genes, from a biological sample obtained from a prostate cancer patient. The genes may be grouped into functional gene subsets for calculating a quantitative score useful to predict a likelihood of a clinical outcome for a prostate cancer patient.

  • USE OF CHOLINE-PHOSPHATE CYTIDYLYLTRANSFERASE-ALPHA (CCT-ALPHA) AS A BIOMARKER FOR CANCER PROGNOSIS

    It has previously been demonstrated that positive 8F1 immunohistochemistry is an indicator of a poor cancer prognosis and poor response to chemotherapy. The 8F1 antibody was generated by immunization against ERCC1, a DNA repair protein, but recognizes a second, previously unidentified protein in cells and tissues. Disclosed herein is the finding that in addition to ERCC1, the 8F1 antibody recognizes the choline phosphate cytidylyltransferase-.alpha. (CCT.alpha.) protein. Thus, provided herein is a method of determining the prognosis of a patient with cancer by specifically detecting expression of CCT.alpha. in a sample obtained from the subject. Also provided is a method of predicting the response of a cancer patient to treatment with a genotoxic therapy by specifically detecting expression of CCT.alpha. in a sample obtained from the subject.

  • VACCINE FOR THE PREVENTION OF BREAST CANCER RELAPSE

    The invention features methods to induce and maintain a protective cytotoxic T-lymphocyte response to a peptide of the HER2/neu oncogene, E75, with the effect of inducing and maintaining protective or therapeutic immunity against breast cancer in a patient in clinical remission. The methods comprise administering to the patient an effective amount of a vaccine composition comprising a pharmaceutically acceptable carrier, an adjuvant such as recombinant human GM-CSF, and the E75 peptide at an optimized dose and schedule. The methods further comprise administering an annual or semi-annual booster vaccine dose due to declining E75-specific T cell immunity. The invention also features vaccine compositions for use in the methods.

  • BLOOD PLASMA BIOMARKERS FOR BEVACIZUMAB COMBINATION THERAPIES FOR TREATMENT OF PANCREATIC CANCER

    The present invention provides methods for improving the treatment effect of a chemotherapy regimen of a patient suffering from pancreatic cancer, in particular metastatic pancreatic cancer by adding bevacizumab (Avastin.RTM.) to a chemotherapy regimen by determining the expression level, in particular the blood plasma expression level, of one or more of VEGFA, VEGFR2 and PLGF relative to control levels of patients diagnosed with pancreatic cancer, in particular metastatic pancreatic cancer. In particular, the present invention provides methods of improving the treatment effect, wherein the treatment effect is the overall and/or progression-free survival of the patient. The present invention further provides methods for assessing the sensitivity or responsiveness of a pancreatic cancer patient to bevacizumab (Avastin.RTM.) in combination with a chemotherapy regimen, using similar methods.

  • PYRIDONE AMIDES AND ANALOGS EXHIBITING ANTI-CANCER AND ANTI-PROLIFERATIVE ACTIVITIES

    Compounds useful in the treatment of mammalian cancers and especially human cancers according to Formula I are disclosed. ##STR00001## Pharmaceutical compositions and methods of treatment employing the compounds disclosed herein are also disclosed.

  • BREAST CANCER PROGNOSIS

    The present invention provides gene expression profiles indicative of whether a patient afflicted with PR driven malignancies is likely to be responsive to treatment with a therapeutic compound that is an anti-progestin. By identifying such responsiveness, a treatment provider may determine in advance those patients who would benefit from such treatment, as well as identify alternative therapies for non-responders. Also, provided are methods of using gene expression profiles and assays for identifying the presence of a gene expression profile in a patient.

  • HIGHLY POTENT PEPTIDES TO CONTROL CANCER AND NEURODEGENERATIVE DISEASES

    This invention provides compositions and method of diminishing or inhibiting autophagy by administering a FLIP protein that binds to Atg3, interfering with the formation of the LC3-Atg4-Atg7-Atg3 conjugation complex necessary for autophagy induction. This invention also provides FLIP peptide fragments that promote or induce autophagy by interfering with the activity of FLIP.

  • METHOD TO DETERMINE RESPONSIVENESS OF CANCER TO EPIDERMAL GROWTH FACTOR RECEPTOR TARGETING TREATMENTS

    Disclosed herein are methods and reagents for determining the responsiveness of cancer to an epidermal growth factor receptor (EGFR) targeting treatment. The detection of these mutations will allow for the administration of gefitinib, erlotinib and other tyrosine kinase inhibitors to those patients most likely to respond to the drug.

  • METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER

    The invention provides compositions with low toxicity and high bioavailability for treating cancer or for inhibiting the development of cancer

  • Compositions and Methods for Diagnosing and Treating Cancer

    Isolated antibodies that specifically bind the human MET Receptor and inhibit MET signaling are described. Also described are methods of treating cancer, the methods comprising administering a therapeutically effective amount of the provided MET antibodies and combinations thereof.

  • METHODS AND COMPOSITIONS FOR DIAGNOSTIC USE IN CANCER PATIENTS

    Disclosed herein are methods and compositions useful for identifying therapies likely to confer optimal clinical benefit for patients with cancer.

  • NANOPROBE COMPRISING GOLD COLLOID NANOPARTICLES FOR MULTIMODALITY OPTICAL IMAGING OF CANCER AND TARGETED DRUG DELIVERY FORCANCER

    The present invention is directed to a nanoparticle loaded with a light sensitive molecule and a method of preparing the nanoparticle, wherein the nanoparticle is a colloidal gold nanoparticle and the light sensitive molecule is non-covalently adsorbed to the surface of the nanoparticle. The present invention is also directed to a nanoprobe comprising the nanoparticle and further comprising a targeting moiety covalently coupled to the surface of the nanoparticle. Additionally, the present invention is directed to an imaging method comprising administering the nanoprobe to a subject and collecting imaging data of the subject or part of the subject with optical multimodality imaging. A method of treating cancer in a subject comprising administering the nanoprobe and performing photodynamic therapy on the subject is further disclosed.

  • METHOD FOR TREATING NON-SMALL CELL LUNG CANCER

    The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-O-methoxyethyl modifications, has nucleotides 5-17 which are 2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.

  • METHODS FOR DIAGNOSING AND TREATING NEUROENDOCRINE CANCER

    The present invention relates to a method for diagnosing neuroendocrine cancers via detecting the presence of N-methyl D-asparate-associated (NMDA) glutamate receptors type 1 and/or type 2. Methods for preventing and treating neuroendocrine cancers are also disclosed.

  • COMBINATION THERAPY FOR TREATMENT OF CANCER

    The present invention relates to methods and compositions for treating cancer. Some embodiments include methods comprising increasing expression of a nucleic acid encoding secreted protein acidic and rich in cysteine (SPARC) protein or SPARC protein or the level or activity of SPARC protein and administering a chemotherapeutic agent to a subject in need thereof.

  • METHOD FOR CANCER IMMUNOTHERAPY

    A novel compound of the formula (1): ##STR00001## wherein X is a tyrosine residue or a methionine residue; Y and Z each are a single bond or the like; R.sup.1 is a hydrogen atom or the like; R.sup.2 is a hydroxy group or the like; R.sup.3 is a hydrogen atom, alkyl group, amino group or the like; R.sup.4 is a hydrogen atom, alkyl group, carboxy group or the like; m is 1 or 2; and n is an integer of 0 to 2, with the proviso that when n is 0, R.sup.3 is a hydrogen atom or an alkyl group, or a pharmaceutically acceptable salt thereof, and its use in cancer immunotherapy.

  • TREATMENT OF METASTATIC BREAST CANCER

    The present invention concerns treatment of previously untreated HER2-positive metastatic breast cancer with a combination of a growth inhibitory HER2 antibody, a HER2 dimerization inhibitor antibody and a taxane. In particular, the invention concerns the treatment of HER2-positive metastatic breast cancer in patients who did not receive prior chemotherapy or biologic therapy with a HER2 antibody binding essentially to epitope 2C4, a HER2 antibody binding essentially to epitope 4D5, and a taxane. The invention further comprises extending survival of such patients by the combination therapy of the present invention. In a preferred embodiment, the treatment involves administration of trastuzumab, pertuzumab and docetaxel.

  • THERAPIES FOR TREATING CANCER

    Provided herein are methods that relate to a novel therapeutic strategy for treatment of cancer, including hematological malignancies such as leukemia, lymphoma, and multiple myeloma. In particular, the method includes administration of a PI3K.delta. inhibitor and a Syk inhibitor.

  • MOLECULAR DIAGNOSTIC TEST FOR CANCER

    Methods and compositions are provided for the identification of a molecular diagnostic test for cancer. The test defines a novel DNA damage repair deficient molecular subtype and enables classification of a patient within this subtype. The present invention can be used to determine whether patients with cancer are clinically responsive or non-responsive to a therapeutic regimen prior to administration of any chemotherapy. This test may be used in different cancer types and with different drugs that directly or indirectly affect DNA damage or repair, such as many of the standard cytotoxic chemotherapeutic drugs currently in use. In particular, the present invention is directed to the use of certain combinations of predictive markers, wherein the expression of the predictive markers correlates with responsiveness or non-responsiveness to a therapeutic regimen.