
Inventi Rapid - Pulmonology
(Formerly Inventi Rapid/Impact: Lungs)

Patent Watch

  • Endotracheal tube with feature for delivering aerosolized medication

    Current methods of drug administration to the lungs are inefficient. `Endotracheal Tube with Aerosol Delivery Apparatus III` is specifically designed for uniform intrapulmonary delivery of aerosolized medication in patients on mechanical ventilation. As opposed to the current methods of drug delivery where aerosol particles are generated at the proximal end of the ETT, with majority of the particles adhering to the endotracheal tube during delivery, this invention bypasses the endotracheal tube by generating aerosol particles at its distal end. The invention consists of two coaxial hollow tubes fused to each other. The inner coaxial tube and/or one or more secondary cannulation(s) in the wall of the outer coaxial tube terminate at proximal and as MDI adapters and at the distal tip as a single or multiple micrometric orifices. The device generates one or more aerosol plumes with different geometries, velocities and orientations made possible by variations in the ID, shape, trajectory and orientation of secondary cannulation(s) and the distal orifice(s) to ensure effective aerosol delivery to respiratory system.

  • Preventing airway mucus production by administration of EGF-R antagonists

    Hypersecretion of mucus in the lungs is inhibited by the administration of an epidermal growth factor receptor (EGF-R) antagonist. The EGF-R antagonist may be in the form of a small organic molecule, an antibody, or portion of an antibody that binds to and blocks the EGF receptor. The EGF-R antagonist is preferably administered by injection in an amount sufficient to inhibit formation of goblet cells in pulmonary airways. The degranulation of goblet cells that results in airway mucus production is thereby inhibited. Assays for screening candidate agents that inhibit goblet cell proliferation are also provided.

  • Monitoring lung fluid status using the cardiac component of a thoracic impedance-indicating signal

    This patent document describes, among other things, systems and methods for monitoring lung fluid status, such as monitoring the presence or absence of pulmonary edema, in a subject using information about the cardiac impedance-indicating component of a measured impedance-indicating signal. In various examples, an amplitude or contribution change over multiple cardiac cycles of the cardiac impedance-indicating component is used to compute and provide a lung status indication. In various examples, a decreasing amplitude or contribution trend of the cardiac impedance-indicating component signifies an increasing amount of fluid in the subject's lungs, as a greater portion of an injected thoracic impedance measurement current formerly traversing the heart is rerouted through the lung due to the less resistance path created by the fluid accumulation therein. In another example, measurements of the impedance-indicating signal, and thus the cardiac impedance-indicating component, are taken at one or a combination of end-inspiration or end-expiration.

  • Continuous high-frequency oscillation breathing treatment apparatus

    A continuous high-frequency oscillation breathing device delivers therapy during both inhalation and exhalation in order to assist in clearing secretions from the lungs. A venturi patient interface circuit is combined with medicated aerosol to deliver continuous high-frequency oscillation therapy. Fixed open apertures in the patient interface circuit allow ingress and egress of flow, and are calibrated to allow exhalation and prevent stacking of successive breaths.

  • Interactive education system for teaching patient care

    A newborn simulator for teaching patient care is provided. The newborn simulator includes a body comprising one or more simulated body portions sized to simulate a newborn baby and a head portion movably connected to a portion of the body. A simulated heart is positioned at least partially within the body along with a pair of simulated lungs. The simulator is operable without physical connection to an external device to provide a simulated heart beat and respiratory pattern.

  • C-reactive protein and its use to treat systemic lupus erythematosus and related conditions

    The present invention relates to the use of C-reactive protein, its mutants, metabolites and polypeptides and related compounds thereof for the treatment of various disease states and conditions associated with systemic lupus erythematosus (SLE), including lupus of the skin (discoid), systemic lupus of the joints, lungs and kidneys, hematological conditions including hemolytic anemia and low lymphocyte counts, lymphadenopathy and CNS effects including memory loss, seizures and psychosis, among numerous others as otherwise disclosed herein, hi another aspect of the invention, the reduction in the likelihood that a patient who is at risk for an outbreak of a disease state or condition with systemic lupus erythematosus will have an outbreak is an additional aspect of the present invention.

  • CPR devices and methods utilizing a continuous supply of respiratory gases

    A method for increasing circulation and providing oxygen to a patient in cardiac arrest includes the step of coupling an interface to the patient's airway, the interface providing access to the patient's respiratory system. A valve system is operably attached to the interface. Oxygen is delivered through the interface a rate of between about 1.0 to about 10.0 L/min to provide a continuous supply of oxygen to the patient. While supplying the oxygen, a body structure of the patient is manipulated to increase the magnitude and duration of the patient's negative intrathoracic pressure. During the manipulation, the valve system prevents additional respiratory gases from entering the lungs until a negative intrathoracic pressure level in the range from about -1 cm H2O to about -15 cm H2O, the valve system assisting in increasing the magnitude and duration of negative intrathoracic pressure thereby enhancing the amount of blood flow in the heart and lungs and lowering intracranial pressure, therein further increasing blood flow to the brain.

  • Imaging elastic properties of the lung with magnetic resonance elastography

    A noble gas is administered to a subject to fill the lungs and magnetic resonance elastography image data is acquired while vibrations are applied to the chest wall. Shear waves are established in the gas-filled lungs by the vibrations and a shear modulus image is reconstructed from the MRE image data that may be used in the diagnosis of lung disease.

  • Methods and Compositions for Delivery of Medicaments to the Lungs

    The disclosure provides a drug composition formulated for inhalation comprising a conjugate of a surface active agent and a pulmonary active drug. The surface active agent has an affinity for the human alveolar/gas interface and comprises at least a portion of a mammalian lung surfactant of a mimic thereof. The disclosure also provides a method of treating a subject suffering from or at risk of suffering from a lung disease comprising administering to the subject a conjugate comprising a drug for lung treatment and a surface active agent by inhalation in an amount effective to induce a drug effect in the lungs.


    The present disclosure relates to oligodeoxynucleotides that suppress an immune response. Methods are disclosed for inhibiting or treating inflammatory lung disease by administering a therapeutically effective amount of a suppressive oligodeoxynucleotide.

  • Treatment and prevention of diffuse parenchymal lung disease by selective active-site mTOR inhibitors

    Embodiments are related to new uses for selective active-site mTOR inhibitors in treating or preventing pulmonary fibrosis in diffuse parenchymal lung disease (DPLD) patients, such as a DPLD of environmental cause, a collagen vascular disease (e.g., scleroderma and rheumatoid arthritis), an idiopathic interstitial pneumonia (e.g., idiopathic pulmonary fibrosis and nonspecific interstitial pneumonia), and sarcoidosis.

  • CGRP Receptor Antagonist

    The disclosure generally relates to the compound of formula I, (R)-N-(3-(7-methyl-1H-indazol-5-yl)-1-(4-(1-methylpiperidin-4-yl)piperazi- n-1-yl)-1-oxopropan-2-yl)-4-(2-oxo-1,2-dihydroquinolin-3-yl)piperidine-1-c- arboxamide, including pharmaceutically acceptable salts, which is a CGRP-receptor antagonist. The disclosure also relates to pharmaceutical compositions and methods for using the compound in the treatment of CGRP related disorders including migraine headaches, neurogenic vasodilation, neurogenic inflammation, thermal injury, circulatory shock, flushing associated with menopause, airway inflammatory diseases such as asthma,chronic obstructive pulmonary disease (COPD), and cancer. ##STR00001##

  • Treatment Of Chronic Obstructive Pulmonary Disease With Phosphodiesterase-4 Inhibitor

    Disclosed is a method of treatment of chronic obstructive pulmonary disease associated with chronic bronchitis in a patient at risk of exacerbations. The method includes administering to a patient with a history ofchronic obstructive pulmonary disease associated with chronic bronchitis and at risk of exacerbations, a maintenance dose of 500 micrograms per day of roflumilast. Also disclosed is a method of increasing pre-bronchodilator FEV.sub.1 or post-bronchodilator FEV.sub.1 in such a patient, and increasing pre-bronchodilator FVC or post-bronchodilator FVC in such a patient. Further disclosed is a method of reducing the rate of exacerbations in such a patient.


    Methods of using prodrugs of GABA analogs and pharmaceutical compositions thereof to treat migraine, fibromyalgia, amyotrophic lateral sclerosis, irritable bowel syndrome, social phobia, Parkinson's disease, asthma, cough, or chronic obstructive pulmonary disease, and pharmaceutical compositions of prodrugs of GABA analogs useful in treating migraine, fibromyalgia, amyotrophic lateral sclerosis, irritable bowel syndrome, social phobia, Parkinson's disease, asthma, cough, or chronic obstructive pulmonary disease are disclosed.

  • Phthalazine Compounds as P38 Map Kinase Modulators and Methods of Use Thereof

    The present invention comprises a new class of compounds useful for the prophylaxis and treatment of protein kinase mediated diseases, including inflammation and related conditions. The compounds have a general Formula I wherein A.sup.4, L, R.sup.1, R.sup.2, R.sup.3, R.sup.5 and m are as defined herein. The invention also comprises pharmaceutical compositions including one or more compounds of Formula I, uses of such compounds and compositions for treatment of p38 map kinase mediated diseases including rheumatoid arthritis, psoriasis, chronic obstructive pulmonary disease, ankylosing spondylitis, pain and other inflammatory disorders, as well as intermediates and processes useful for the preparation of compounds of Formula I.


    The invention is directed to novel indole carboxamide compounds. Specifically, the invention is directed to compounds according to formula (I): ##STR00001## wherein R1, R2, R3, R4, and m are as defined herein. The compounds of the invention are inhibitors of IKK2 and can be useful in the treatment of disorders associated with inappropriate IKK2 (also known as IKK.beta.) activity, such as rheumatoid arthritis, asthma, rhinitis, and COPD (chronic obstructive pulmonary disease). Accordingly, the invention is further directed to pharmaceutical compositions comprising a compound of the invention. The invention is still further directed to methods of inhibiting IKK2 activity and treatment of disorders associated therewith using a compound of the invention or a pharmaceutical composition comprising a compound of the invention.


    Combinations comprising (a) a .beta.2 agonist and (b) an antagonist of M3 muscarinic receptors which is 3(R)-(2-hydroxy-2,2-dithien-2-ylacetoxy)-1-(3-phenoxypropyl)-1-azoniabicy- clo[2.2.2]octane, in the form of a salt having an anion X, which is a pharmaceutically acceptable anion of a mono or polyvalent acid are useful, e.g., for the treatment of respiratory disease, e.g., asthma or chronic obstructive pulmonary disease.

  • Deuterium-enriched pyrimidine compounds and derivatives

    The present invention is concerned with deuterium-enriched pyrimidine compounds of formula I, their derivatives and pharmaceutically acceptable salts and methods of use thereof ##STR00001## for the prevention and treatment of cancer including brain cancer, breast cancer, blood cancer, colorectal cancer, lung cancer, liver cancer, ovarian cancer, pancreas cancer, prostate cancer, stomach cancer, testicular cancer, uterus cancer, intestinal cancer, skin cancer, and other forms of cancer; tumor progression, metastasis and fibrosis in the neuroendocrine neoplasia, fibrotic processes associated with neuroendocrine cell dysregulation for example Crohn's disease, pulmonary arterial hypertension, pulmonary hypertension associated with chronic obstructive pulmonary disease (COPD), right ventricular hypertrophy, pulmonary vascular remodeling, asthma, cystic fibrosis, hypertension, ischemic stroke, angina pectoris, congestive heart failure, arrhythmia, arterial fibrillation, neurodenerative diseases, Alzheimer's disease, dementia, cognition impairment, memory decline, schizophrenia, dementia associated with Parkinson's and Huntington's disease, Pick's disease and Jacob disease, gastrointestinal disorders including irritable bowel syndrome, gastroesophageal reflux disease, Crohn's disease, gastric emptying disorders, gastritis, emesis, nausea, vomiting, prokinesia, non-ulcer dyspepcia, urinary incontinence, feeding disorders, bulimia, anorexia, obesity, constipation, constipation, and respiratory depression, stress disorders, post-traumatic stress disorder, acute stress disorder, delirium, anxiety, depression, bipolar depression, epilepsy, Down's syndrome, pain, migraine, panic disorders, social phobia, animal phobias, and obsessive compulsive disorders, substance-related disorders including dependence and abuse, intoxication, withdrawal, and delirium arising from the use of alcohol, amphetamines, cannabis, cocaine, hallucinogens, inhalants, nicotine, opioids, hypnotics, and anxiolytics, demyelinating diseases including multiple sclerosis, ALS, peripheral neuropathy, postherpetic neurolegia, cereberal vascular disorders, acute or chronic cereberovascular damage, cerebral infarction, subarachanoid hemorrhage, and cerebral edema, bronchoconstriction, vasodilation, smooth muscle contraction, brain disorders, vascular disorders, blood flow disorders as a result of vasodilation and vasospastic diseases such as angina, vascular headache, Reynaud's disease, pulmonary hypertension, and systemic hypertension; neuropathological diseases such as Alzheimer's diseases, Parkinson's disease, huntington's disease; cardiovascular system regulation, prophylaxis and treatment of cerebral infarct, stroke, cerebral ischemia; as well as the treatment of diseases of the intestinal tract, stress-related somatic disorders, bladder function disorders such as cystitis, stress-related urinary incontinence, urinary incontinence post prostate cancer-surgery, reflex sympathetic dystrophy including shoulder/hand syndrome, bladder function disorders such as cystitis, and any nociception, pain or migraine associated with the above mentioned conditions.


    An ameliorating agent for chronic obstructive pulmonary disease (COPD) containing as an active ingredient a lecithinized superoxide dismutase represented by the following general formula (I): SOD'(Q-B).sub.m (I) (in the formula SOD' represents a residue of the superoxide dismutase; Q represents a chemical crosslinking; B represents a residue without a hydrogen atom of a hydroxyl group of lysolecithin having the hydroxyl group at the 2-position of glycerol; m is the average number of bonds of lysolecithin to one molecule of superoxide dismutase and represents an integer of 1 or more). The ameliorating agent for COPD is intravenously administered or inhalation-administrated.

  • Methods of Detecting and Treating Pulmonary Disease and Markers Thereof

    The present invention relates to the treatment of pulmonary diseases. More specifically, the invention relates to new methods of detecting and treating chronic obstructive pulmonary disease (COPD). In particular, the invention relates to a method of measuring one or more lipid metabolites in human body fluids as an indicator/biomarker of the progress of chronic obstructive pulmonary disease. The present invention also relates to a method of detecting and/or monitoring chronic obstructive pulmonary disease in a subject, the method comprising measuring the level of at least one lipid metabolite in a sample from the subject, wherein said level is indicative of COPD. The present invention also relates to a method of assessing the efficacy of a COPD treatment in a subject, the method comprising a step of measuring the level of at least one lipid metabolite in a sample from the subject, wherein said level is indicative of COPD severity or status.


    The present invention is directed toward respirable dry particles for delivery of divalent metal cation salts and/or monovalent cation salts to the respiratory tract and methods for treating a subject having a respiratory disease and/or infection.

  • Sulfonamide Compounds for the Treatment of Respiratory Disorders

    Compounds of formula (I) are agonists of PPAR.gamma., useful for the treatment of respiratory disease; formula (I): wherein R.sub.1, R.sub.2 or R.sub.3 each independently represents halo, cyano, nitro, amino, alkyl, haloalkyl, alkoxy, haloalkoxy, carboxylic acid or an ester or amide thereof; R.sub.4 represents hydrogen or alkyl; m, n or p independently represents 0, 1, 2 or 3. ##STR00001##

  • Pharmaceutical Product Comprising a P38 Kinase Inhibitor and a Second Active Ingredient

    The invention provides a pharmaceutical product, kit or composition comprising a first active ingredient which is N-Cyclopropyl-3-fluoro-4-methyl-5[3-[[1-[2-[2-(methylamino)ethoxy]phenyl]- cyclopropyl]amino]-2-oxo-1(2H)-pyrazinyl]-benzamide or a salt thereof, and a second active ingredient selected from: a non-steroidal Glucocorticoid Receptor (GR Receptor) Agonist; an antioxidant; a .beta.2 adrenoceptor agonist; a CCR1 antagonist; a chemokine antagonist (not CCR1); a corticosteroid; a CRTh2 antagonist; a DPI antagonist; an Histone Deacetylase activator; an IKK2 kinase inhibitor; a COX inhibitor; a lipoxygenase inhibitor; a leukotriene receptor antagonist; a MABA compound; an MPO inhibitor; a muscarinic antagonist; a PDE4 inhibitor; a PPAR.gamma. agonist; a protease inhibitor; a Statin; a thromboxane antagonist; a vasodilator; or, an ENAC blocker (Epithelial Sodium-channel blocker); and its use in the treatment of respiratory disease.


    Combinations comprising (a) a .beta.2 agonist and (b) an antagonist of M3 muscarinic receptors which is 3(R)-(2-hydroxy-2,2-dithien-2-ylacetoxy)-1-(3-phenoxypropyl)-1-azoniabicy- clo[2.2.2]octane, in the form of a salt having an anion X, which is a pharmaceutically acceptable anion of a mono or polyvalent acid are useful, e.g., for the treatment of respiratory disease, e.g., asthma or chronic obstructive pulmonary disease.

  • Materials and methods for respiratory disease control in canines

    The subject invention pertains to isolated influenza virus that is capable of infecting canids and causing respiratory disease in the canid. The subject invention also pertains to compositions and methods for inducing an immune response against an influenza virus of the present invention. The subject invention also pertains to compositions and methods for identifying a virus of the invention and diagnosing infection of an animal with a virus of the invention.


    Methods and compositions are provided for treating lung diseases, including but not limited to infections and small cell and non-small cell lung cancer, by conjugating a drug of interest to glycerol ethers or glycerol phosphate ethers.

  • Artificial Lung

    The invention relates to an artificial lung for simulating the stress by a user when testing a breathing apparatus, particularly a compressed air breathing apparatus, comprising a housing, which surrounds a pulmonary space for the breathing air and has a connection for supplying the breathing air to the breathing apparatus. In order to be able to variably control the volume flow for generating a certain respiration curve, the housing (2) surrounding the pulmonary space for the breathing air is provided with an inlet (5) and with an outlet (6) for the breathing air, a fan (7, 8) is connected to the inlet and outlet (5, 6), respectively, for supplying and removing the breathing air, and a cover (13), which can be actuated by way of a drive (16) and encloses the pulmonary space (3), is disposed in the housing (2), which cover controls the volume flow of the breathing air between the inlet (5) for the breathing air and the connection (4) for the supply of the breathing air to the breathing apparatus, and/or between the connection (4) and the outlet (6) for removing the breathing air, so as to generate the breathing curve.


    Provided are compositions and methods for treating lung or respiratory disorders or conditions characterized by airflow obstruction or limitation, or symptoms thereof (e g, asthma, rhinitis, allergic rhinitis, and chronic obstructive pulmonary disease (CaPO) and CaPO-associated conditions (e g, bronchitis, emphysema, asthma), emphysema, pneumonia, bronchitis, in-fluenza, SARS, tuberculosis, and whooping cough (pertussis), and the like) comprising administering a therapeutic composition comprising at least one electrokinetically altered fluid comprising an ionic aqueous solution of charge-stabilized oxygen containing nanostructures as disclosed herein, or comprising administering a nonelectrokinetic superoxygenated aqueous solution The methods preferably comprise regulating intracellular signal transduction by modulation of at least one of cellular membranes, membrane potential, membrane proteins (e g, membrane receptors, (e g, G protein-coupled receptors, and intercellular junctions)) Additional aspects include therapeutic compositions, and combination treatment methods comprising administration of electrokinetically generated fluid in combination with at least one additional therapeutic agent (e g, albuterol, etc).


    The present invention provides novel methods for diagnosing diseases based on the determination of specific miRNAs that have altered expression levels in disease states compared to healthy controls.

  • Semi-Invasive Method for Characterizing Lung Injury

    Described and disclosed are methods for determining, predicting, diagnosing, treating, and monitoring lung diseases, including bronchiolitis obliterans syndrome and acute cellular rejection in a lung transplant recipient by measuring chemokine levels in bronchoalveolar lavage (BAL) samples. The chemokine CXCL10 is measured in combination with at least one analyte selected from the group consisting of IL1RA, CXCL11, MCP-1, CXCL9, RANTES, IL-13, IL-17, IL-22, fractalkine, and eotaxin; and/or biomarkers. The present teachings also relate to methods, treatment decisions and kits for detecting and monitoring onset of lung transplant rejection in advance of clinically recognized symptoms.


    A method of minimally invasively reducing a volume of a hyper-inflated target section of diseased lung comprising the steps of introducing a bronchoscope into a patient's airway to a position adjacent the target section and equilibrating air within the target section with atmospheric air to at least partially deflate the target lung section; injecting an inflammation-causing substance into the target section to precipitate adhesion of the walls within the target lung section, preventing substantial re-inflation of the target section by occluding an airway upstream of the target section for a period of time, and removing the airway occlusion after the target section has substantially permanently been reduced in volume. The injected substance can be autologous blood or a constituent thereof.

  • Lung Cancer Biomarkers and Uses Thereof

    The present disclosure includes biomarkers, methods, devices, reagents, systems, and kits for the detection and diagnosis of non-small cell lung cancer and general cancer. In one aspect, methods are provided for diagnosing non-small cell lung cancer, where the methods include detecting, in a sample, at least one biomarker value corresponding to at least one biomarker selected from the biomarkers provided in Table 1, wherein an individual is classified as having lung cancer, or the likelihood of having lung cancer is determined, based on the at least one biomarker value. In another aspect, methods are provided for diagnosing cancer, where the methods include detecting, in a sample, at least one biomarker value corresponding to at least one biomarker selected from the biomarkers provided in Table 19, wherein an individual is classified as having cancer, or the likelihood of having cancer is determined, based on the at least one biomarker value.


    Provided is a gene expression signature consisting of 12 biomarkers for use in prognosing or classifying a subject with lung squamous cell carcinoma into a poor survival group or a good survival group. The 12-gene signature specific for squamous cell carcinoma consists of the biomarkers RPL22, VEGFA, G0S2, NES, TNFRSF25, DKFZP586P0123, COL8A2, ZNF3, PJPK5, RNFT2, ARHGEF12 and PTPN20A.


    Diagnosis of lung cancer in a subject before onset of symptoms is described herein (i.e., in a pre-diagnostic subject), by screening a biological fluid from the subject for the presence therein of autoantibodies that are specific for one or more pre-diagnostic lung cancer indicator proteins, including LAMR1, and optionally additionally or alternatively including annexin I and/or 14-3-3-theta and/or other pre-diagnostic lung cancer indicator proteins as presently disclosed, as the defined antigens. Related methods, including for monitoring immune reactivity against lung cancer indicator proteins in a lung cancer patient, typing lung cancer subjects or characterizing lung tumors, and application of the described proteomics approach for the identification of additional pre-diagnostic lung cancer indicator proteins, are also contemplated.


    The present invention provides methods for treating patients with acute or chronic lung disease or injury to the lungs including injury caused by exposure to cigarette smoke other irritants or another cause of pulmonary distress. Typical conditions that can be treated include conditions that cause inflammation in the lung or the death of lung endothelial cells. Treatment of other conditions such as compromised bone marrow function and cachexia can also be treated by the inventive methods disclosed herein. These methods including contacting Adipose Stem Cells (ASC) or media conditioned by contact with ASC (ASC-CM) or various factors secreted by the same including the media or components of the media with lung tissue and cells. In some instances the ASC used is harvested from the patient's own adipose tissue while in other instances the source is an exogenous donor.


    The present invention provides methods for dilating the bronchi or bronchioles and relaxing a pulmonary smooth muscle in a subject by treating the subject with a pharmaceutical composition, which includes a Histone deacetylase (HDAC) inhibitor. The ability to dilate the bronchi or bronchioles and relax a pulmonary smooth muscle according to the methods of the invention allows treating, alleviating, or inhibiting bronchoconstrictive diseases or disorders and symptoms associated or derived from bronchoconstrictive diseases.


    Provided are: a method of preparing cells that simultaneously express a type II alveolar epithelial cell marker and a stem cell marker, including a process of isolating and extracting constituent cells from human lung tissue, and a process of separating and culturing lung tissue stem cells from the obtained isolated cells; human lung tissue stem cells that are obtained from the method of preparation and are able to differentiate into alveolar epithelial cells; a method of inducing differentiation into human lung epithelial cells, consisting of culturing the human lung tissue stem cells; human alveolar epithelial cells prepared through the method of inducing differentiation; and a method of screening that uses the human lung tissue stem cells or human alveolar epithelial cells.


    comprises receiving first data which has been obtained from the subject, and inputting said first data to a model of lung function to generate said data indicative of lung function. The model of lung function comprises a first model component modelling transfer of gaseous oxygen from a gaseous space within the lung to biological material within the lung based upon quantitative data indicative of oxygen content in the inhaled gases and oxygen content in the biological material and a second model component modelling the transfer of oxygen from the lungs by oxygenation of venous blood to create oxygenated blood based upon quantitative data indicative of oxygen content in the venous blood.

  • Methods for Diagnosing Lung Cancer Using MicroRNA Signatures

    The present invention provides novel methods and compositions for the diagnosis and treatment of solid cancers. The invention also provides methods of identifying inhibitors of tumorigenesis.

  • Methods for Diagnosing Breast and Lung Cancer Using miR-210 and miR-213

    The present invention provides novel methods and compositions for the diagnosis and treatment of solid cancers. The invention also provides methods of identifying inhibitors of tumorigenesis.


    The invention is directed to protein or nucleic acid assays for diagnosis, prognosis and monitoring of lung cancers, in particular small cell lung cancer using biomarkers comprising haptoglobin isoforms, or fragments or variants thereof.

  • Lung Compliance Simulation System and Associated Methods

    A patient simulator system for teaching patient care is provided. The system includes a patient simulator. The patient simulator includes a patient body comprising one or more simulated body portions. The one or more simulated body portions include a lung compliance simulation system in some instances. In that regard, the lung compliance system is configured to be used with an external ventilator, including positive end-expiratory pressure (PEEP) and assisted-control ventilation. In some instances, the lung compliance system includes a lung compartment, a simulated lung positioned within the lung compartment, where the lung compartment defines an available volume for the simulated lung to expand into and where the available volume for the simulated lung to expand into is adjustable to control a compliance of the simulated lung.

  • ROS Kinase in Lung Cancer

    The invention provides the identification of the presence of polypeptides with ROS kinase activity in mammalian lung cancer. In some embodiments, the polypeptide with ROS kinase activity is the result of a fusion between a ROS-encoding polynucleotide and a polynucleotide encoding a second (non-ROS) polypeptide. Three different fusion partners of ROS are described, namely proteins encoded by the FIG gene, the SLC34A2 gene, and the CD74 gene. The invention enables new methods for determining the presence of a polypeptide with ROS kinase activity in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer (e.g., an lung cancer).


    The present invention provides methods of providing a prognosis for a lung cancer in a subject and methods of predicting the risk of metastasis of a lung cancer in a subject. The present invention additionally provides kits that find use in the practice of the methods of the invention.


    The present invention provides methods for diagnosis and prognosis of lung cancer using expression analysis of one or more groups of genes, and a combination of expression analysis from a nasal epithelial cell sample. The methods of the invention provide far less invasive method with a superior detection accuracy for lung cancer when compared to any other currently available method for lung cancer diagnostic or prognosis. The invention also provides methods of diagnosis and prognosis of other lung diseases, such as lung cancer.

  • Method, device, or system using lung sensor for detecting a physiological condition in a vertebrate subject

    Devices, systems, and methods are disclosed herein for detecting one or more physiological conditions in lungs of a vertebrate subject. A method is described for administering at least one microparticle to lungs of a vertebrate subject, wherein the at least one microparticle includes one or more markers; wherein the one or more markers is configured to be released in response to one or more physiological conditions in the vertebrate subject; and detecting the one or more markers in a lung exhalant of the vertebrate subject.


    Administration of aerosolized Treprostinil formulations may provide a more homogeneous lung deposition of treprostinil, whereby making deep lung delivery possible.

  • Lung Volume Reduction Devices, Methods, and Systems

    The invention provides improved medical devices, therapeutic treatment systems, and treatment methods for treatment of the lung. A lung volume reduction system includes an implantable device having an elongate body that is sized and shaped for delivery via the airway system to a lung airway of a patient. The implant is inserted and positioned while the implant is in a delivery configuration, and is reconfigured to a deployed configuration so as to locally compress adjacent tissue of the lung, with portions of the elongate body generally moving laterally within the airway so as to laterally compress lung tissue. A plurality of such implants will often be used to treat a lung of a patient.


    The present invention relates to methods and compositions that may be used to predict the risk of an individual, for example a smoker, for developing chronic obstructive pulmonary disease ("COPD"), emphysema or idiopathic pulmonary fibrosis ("IPF").


    Devices, systems, and methods for measuring the diameter of an airway in a human or animal subject are disclosed. The device comprises a flexible catheter body having a proximal end and a distal end. Flexible sizing elements are disposed along and extend approximately orthogonally from the catheter body. The sizing elements have different heights from one another and are configured to fit through the working channel of a bronchoscope. Devices, systems, and methods for redirecting airflow through a lung airway are also disclosed. The method comprises introducing into the airway a catheter comprising a distal end, a proximal end and an elongated portion therebetween, wherein the distal end comprises an airway closing mechanism, and wherein the proximal end comprises an actuator to actuate the airway closing mechanism; and actuating the airway closing mechanism to at least partially close the airway.


    The lung compliance of a subject that is at least partially self-ventilating is determined. The quantification of lung compliance may be an estimation, a measurement, and/or an approximate measurement. The quantification of lung compliance may be enhanced over conventional techniques and/or systems for quantifying lung compliance of self-ventilating subjects in the lung compliance may be quantified relatively accurately without an effort belt or other external sensing device that directly measures diaphragmatic muscle pressure, and without requiring the subject to manually control diaphragmatic muscle pressure. Quantification of lung compliance may be a useful tool in evaluating the health of the subject, including detection of fluid retention associated with developing acute congestive heart failure.


    An intra-bronchial device may be placed and anchored in an air passageway of a patient to collapse a lung portion associated with the air passageway. The device includes an obstructing member that prevents air from being inhaled into the lung portion, and an anchor that anchors the obstruction device within the air passageway. The anchor may piercingly engage the air passageway wall. The anchor may be releasable from the air passageway for removal of the obstructing member. The anchor may be releasable by collapsing a portion of the obstructing member, or by drawing the obstructing member toward the larynx. The obstructing member may be a one-way valve.


    Modified Rv3616c proteins and their use as medicaments, particularly for the prevention of reactivation of tuberculosis.


    Method for detecting M. tuberculosis antigens, comprising: a) contacting a sample of a biological fluid with a solid support; b) adding an amount of a first antibody against at least one M. tuberculosis protein; c) screening for the presence of M. tuberculosis proteins in the biological fluid by adding an amount of a second antibody which binds to the first antibody, in a Miniblotter device.

  • Delivery of Submicrometer and Nanometer Aerosols to the Lungs Using Hygroscopic Excipients or Dual Stream Nasal Delivery

    Pharmaceutically engineered aerosols (e.g. submicrometer and nano-particles and droplets) containing a hygroscopic growth excipient or agent are employed to improve the delivery of respiratory aerosols to the lung. Inclusion of the hygroscopic agent results in near zero depositional loss in the nose-mouth-throat regions and near 100% deposition of the aerosol in the lung. Targeting of the aerosol to specific lung depths is also possible. In addition, methods and apparatuses for delivering aerosols to the lung are provided. The aerosol is delivered to one nostril of a patient while a relatively high humidity gaseous carrier is delivered to the other nostril, resulting in post-nasopharyngeal growth of the aerosol to a size that promotes deposition in the lung.


    A 2D or 3D velocity field is reconstructed from a cross-correlation analysis of image pairs of a sample, without first reconstructing images of the sample spatial structure. The method can be implemented via computer tomographic X-ray particle image velocimetry, using multiple projection angles, with phase contrast images forming dynamic speckle patterns. Estimated cross-correlations may be generated via convolution of a measured autocorrelation function with a velocity probability density function, and the velocity coefficients iteratively optimised to minimise the error between the estimated cross-correlations and the measured cross-correlations. The method may be applied to measure blood flow, and the motion of tissue and organs such as heart and lungs.


    Methods for the treatment of asthma are provided, which comprise: (a) providing an implantable or insertable medical device that comprises an asthma treatment agent; and (b) inserting or implanting the medical device within the lungs (e.g., the trachea or the bronchial tree) of a patient, whereupon the therapeutic agent is delivered to the patient in an amount effective to reduce or eliminate the symptoms of asthma. Also disclosed herein are medical devices and kits for carrying out such methods.

  • Method of treating tuberculosis with interferons

    A method of treating tuberculosis comprising administering an aerosolized interferon such as interferon .alpha., interferon .beta. or interferon .gamma. in a therapeutically effective amount is provided herein. Further, a method of reducing the infectivity of tuberculosis or reducing the number of infectious organisms present in the lungs of a patient suffering from tuberculosis comprising administering an aerosolized interferon such as interferon .alpha., interferon .beta. or interferon .gamma. in a therapeutically effective amount is provided herein. Also, pharmaceutical compositions of one or more aerosolized interferon(s) are provided.


    A method for generating data indicative of lung function of a subject. The method comprises receiving first data which has been obtained from the subject, and inputting said first data to a model of lung function to generate said data indicative of lung function. The model of lung function comprises a first model component modelling transfer of gaseous oxygen from a gaseous space within the lung to biological material within the lung based upon quantitative data indicative of oxygen content in the inhaled gases and oxygen content in the biological material and a second model component modelling the transfer of oxygen from the lungs by oxygenation of venous blood to create oxygenated blood based upon quantitative data indicative of oxygen content in the venous blood.


    Systems, assemblies, and methods to treat pulmonary diseases are used to decrease nervous system input to distal regions of the bronchial tree within the lungs. Treatment systems damage nerve tissue to temporarily or permanently decrease nervous system input. The treatment systems are capable of heating nerve tissue, cooling the nerve tissue, delivering a flowable substance that cause trauma to the nerve tissue, puncturing the nerve tissue, tearing the nerve tissue, cutting the nerve tissue, applying pressure to the nerve tissue, applying ultrasound to the nerve tissue, applying ionizing radiation to the nerve tissue, disrupting cell membranes of nerve tissue with electrical energy, or delivering long acting nerve blocking chemicals to the nerve tissue.


    The present invention is related to a M. tuberculosis fusion protein, polynucleotide coding for said protein, and a vector and host cell that contain said polynucleotide. The present invention also involves the preparation of said fusion protein, and the use thereof in preventions and treatment of tuberculosis.


    The present invention is related to a M. tuberculosis fusion protein, polynucleotide coding for said protein, and a vector and host cell that contain said polynucleotide. The present invention also involves the preparation of said fusion protein, and the use thereof in preventions and treatment of tuberculosis.


    The invention is the use of a therapeutically effective amount of glutathione (reduced) in a liposome encapsulation for oral administration to improve symptoms of illnesses that are related to tuberculosis and HIV and more generally viruses and for the treatment and prevention of virus, particularly HHV-6 and EBV, which liposomal encapsulation of glutathione (reduced) is referred to as liposomal glutathione. The application references specifically reduced glutathione and its importance, and how to stabilize it effectively so it can be taken orally, and need not be refrigerated. New uses for tuberculosis are discussed. The combination is proposed of reduced glutathione and Highly Active Anti-Retroviral Therapy having at least one pharmaceutical composition selected from the group of Nucleoside/tide Reverse Transcriptase Inhibitors (NRTIs), Protease Inhibitors (PIs), and Non-nucleoside Reverse Transcriptase Inhibitors (NnRTIs), and further anti-tuberculosis drugs.

  • Method of treating tuberculosis with interferons

    A method of treating tuberculosis comprising administering an aerosolized interferon such as interferon .alpha., interferon. beta. or interferon .gamma. in a therapeutically effective amount is provided herein. Further, a method of reducing the infectivity of tuberculosis or reducing the number of infectious organisms present in the lungs of a patient suffering from tuberculosis comprising administering an aerosolized interferon such as interferon .alpha., interferon .beta. or interferon .gamma. in a therapeutically effective amount is provided herein. Also, pharmaceutical compositions of one or more aerosolized interferon(s) are provided.


    A method for determining pulmonary fibrosis subtype and/or prognosis in a subject having pulmonary fibrosis comprising: a. determining an expression profile by measuring the gene expression levels of a plurality of genes selected from genes listed in Table 1, 2, 3, 4 7, 8, 9, and/or 10, in a sample from the subject; and b. classifying the subject as having a good prognosis or a poor prognosis based on the expression profile; wherein a good prognosis predicts decreased risk of post lung transplant primary graft dysfunction, and wherein a poor prognosis predicts an increased risk of post lung transplant primary graft dysfunction.


    The present invention provides methods for diagnosis and prognosis of lung cancer using expression analysis of one or more groups of genes, and a combination of expression analysis with bronchoscopy. The methods of the invention provide far superior detection accuracy for lung cancer when compared to any other currently available method for lung cancer diagnostic or prognosis. The invention also provides methods of diagnosis and prognosis of other lung diseases, particularly in individuals who are exposed to air pollutants, such as cigarette or cigar smoke, smog, asbestos and the like air contaminants or pollutants


    Methods, systems and devices are described for new modes of ventilation in which specific lung areas are ventilated with an indwelling trans-tracheobronchial catheter for the purpose of improving ventilation and reducing hyperinflation in that specific lung area, and for redirecting inspired air to other healthier lung areas. Trans-tracheobronchial Segmental Ventilation (TTSV) is performed on either a naturally breathing or a mechanical ventilated, patient by placing a uniquely configured indwelling catheter into a bronchus of a poorly ventilated specific lung area and providing direct ventilation to that area. Typically the catheter's distal tip is anchored without occluding the bronchus. TTSV is optionally performed by insufflation only of the area, or by the application of vacuum to the area, can include elevating or reducing the pressure in the targeted area to facilitate stagnant gas removal, or can include blocking the area to divert inspired gas to better functioning areas.


    The present invention relates to a method for determining the survival prognosis of patients suffering from non-small cell lung cancer. More specifically, the present invention provides methods which measure kinase activity by studying phosphorylation levels in response to a kinase inhibitor and profiles in samples obtained from patients diagnosed with non-small cell lung cancer. The present invention also provides methods for predicting the response of a patient diagnosed with non-small cell lung cancer to a medicament.


    A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-O-methoxyethyl modifications, has nucleotides 5-17 which are 2' deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.


    A cancer testis antigen biomarker useful to determine whether a non- small cell lung cancer tumor is likely to respond to neoadjuvant chemotherapy is provided. Methods of using the biomarker in the diagnosis, treatment and prognosis of non-small cell lung cancer also are provided.


    Non-natural oligomers have recently shown promise as functional analogues of lung surfactant proteins Band C (SP-B and SP-C), two helical and amphiphilic proteins that are clitical for normal respiration. The generation of non-natural mimics of SP-B and SP-C has previously been restlicted to step-by-step, sequence-specific synthesis, which results in discrete oligomers that are intended to manifest specific structural attributes. Presented herein an alternative approach to SP-R mimicry that is based on sequence-random copolymers containing cationic and lipophilic subunits. These materials, members of the nylon-3 family, arc prepared by ling-opening polymelization of 13-lactams. The best of the nylon-3 polymers display promising in vitro surfactant activities in a mixed lipid film. Pulsating bubble surfactometry data indicate that films containing the most surface-active polymers attain adsorptive and dynamic-cycling properties that surpass those of discrete peptides intended to mimic SP-B.

  • Compositions and Methods of Treating and Preventing Lung Cancer and Lymphangioleiomyomatosis

    Compositions and methods for treating and preventing cancer, particularly lung cancer, lymphangioleiomyomatosis and asthma are provided.

  • Compositions, Products, Therapeutic Uses and Procedures for the Production and/or Crystallization of Extracts of Encelia Canescens LAM (Coronilla De Fraile)

    The present invention relates to a composition containing extracts of Encelia canescens Lam and to aqueous or ethanolic extracts obtained therefrom, the procedure for the obtainment and crystallization thereof, and the uses thereof for the prevention and treatment of cancer, for example cancer of the pancreas, gastric tract, prostate, breast, kidney, colon, lung, vesicle, uterus, oral cavity, colorectal region, bladder, liver, brain tumors, and chronic and acute leukemia, in addition to metabolic diseases such as diabetes mellitus types I and II, viral and bacterial diseases, in particular related to E. coli, Kiebsiella, M flavus, S. aureus and B. subtilis. Furthermore the use thereof is claimed in diseases related to oxidative stress and as a useful agent in the preparation of analgesics.


    Disclosed are: a substance transfer carrier to an extracellular matrix-producing cell in the lung, which comprises a retinoid; a therapeutic agent for pulmonary fibrosis, which utilized the carrier; and a preparation kit of the therapeutic agent.


    A transducer system is disclosed for detecting actual or simulated body sounds. An audio signal generation and detection system is disclosed for the purposes of simulating the medical examination of a patient or simulating the listening of sounds seeming to emanate from a live or inanimate body. A signal generator sets up a voltage potential at an electrode physically attached to the body, or electrically connected to a body, thereby setting up a voltage potential on a surface area of the body. An electric field potential sensor or a capacitive electrical sensor placed in proximity to the electrode or body surface then detects the voltage potential. The signals produced by the signal generator can represent heart, lung, bowel or other sounds and the electrical sensor can take the physical form of a listening device such as a stethoscope, thereby creating a simulation of listening to body sounds for medical diagnostic purposes.

  • Dry powder inhaler

    It has a complex shaped hollow body with front mouthpiece (2) covered by dust cap. Drug strip (1) is held in channel (7) with a drug hole (6). Handle (4) with a sharp piercing rod (5) moves on a pivot (10) at the body back. The pierced powder falls through drug hole (6) into drug chamber (23) with a bottom sliding drug release plate (11) having a knob (8), a spring (14) enclosed in sleeves (15,17) and having a drug hole (12). The hollow body has the back air hole (3) with a dust filter (22), then narrows to a jet hole (19) & continues as hollow mouthpiece. A baffle mesh (16) breaks falling powder into a spray. To use, drug strip (1) is pierced by handle (4), inhaler kept in mouth, and knob (8) pressed and inhaled. Plate (11) slides drug hole (12), drug falls on baffle (16), air jet breaks and forms drug spray for more lung deposit. For drugs in capsule, the inhaler is modified with middle placed capsule (26) with a back piercing rod (25).


    Methods and devices for treating reversible chronic obstructive pulmonary disease are disclosed, which include a device for delivering energy to a wall of an airway in a human lung. The device includes a flexible elongate body with a proximal portion, a distal portion, a distal end, and a lumen extending therebetween. The device also includes a deployment member having an electrically conducting wire extending from the proximal portion of the elongate body and extending through the lumen and terminating at a distal tip distal to the distal end of the elongate body. The device further includes an expandable basket having a plurality of curved electrode legs and a temperature sensing element coupled to the expandable basket.


    Methods and devices for treating reversible chronic obstructive pulmonary disease are disclosed, which include a device for delivering energy to a wall of an airway in a human lung. The device includes a flexible elongate body with a proximal portion, a distal portion, a distal end, and a lumen extending therebetween. The device also includes a deployment member having an electrically conducting wire extending from the proximal portion of the elongate body and extending through the lumen and terminating at a distal tip distal to the distal end of the elongate body. The device further includes an expandable basket having a plurality of curved electrode legs and a temperature sensing element coupled to the expandable basket.


    Control systems and methods for delivery of energy that may include control algorithms that prevent energy delivery if a fault is detected and may provide energy delivery to produce a substantially constant temperature at a delivery site. In some embodiments, the control systems and methods may be used to control the delivery of energy, such as radiofrequency energy, to body tissue, such as lung tissue.

  • Methods Of Classifying Biological Samples For Predicting Response To Tyrosine Kinase Inhibitor Treatment

    Gene copy numbers of signaling components downstream of EGFR identify non-small cell lung cancer (NSCLC) patients with poor outcomes on 2nd/3rd line gefitinib therapy.

  • Lung Volume Reduction Devices, Methods, and Systems

    The invention provides improved medical devices, therapeutic treatment systems, and treatment methods for treatment of the lung. A lung volume reduction system includes an implantable device having an elongate body that is sized and shaped for delivery via the airway system to a lung airway of a patient. The implant is inserted and positioned while the implant is in a delivery configuration, and is reconfigured to a deployed configuration so as to locally compress adjacent tissue of the lung, with portions of the elongate body generally moving laterally within the airway so as to laterally compress lung tissue. A plurality of such implants will often be used to treat a lung of a patient.


    The present invention describes methods for using Treprostinil or its derivative, or a pharmaceutically acceptable salt thereof, for the treatment and/or prevention of interstitial lung disease or asthma, or a condition, such as pulmonary fibrosis, associated with interstitial lung disease or a condition associated with asthma. The invention also relates to kits for treatment and/or prevention of such condition that include an effective amount of Treprostinil or its derivative, or a pharmaceutically acceptable salt thereof.


    Kits for assessing lung cancer in patients with solitary pulmonary nodules and methods for assessing lung cancer. The kit includes reagents for detection and/or quantification of serum secretory phospholipase A.sub.2-IIA in plasma, reagents for detection and/or quantification of carcinoembryonic antigen in plasma, and reagents for detection and/or quantification of cytokeratin-19 fragment in plasma. The method includes contacting a sample with a specific binding agent for serum secretory phospholipase A.sub.2-IIA, a specific binding agent for carcinoembryonic antigen, and a specific binding agent for cytokeratin-19 fragment, calculating levels of serum secretory phospholipase A.sub.2-IIA, carcinoembryonic antigen, and cytokeratin-19 fragment, and assessing as indicating lung cancer in the patient if the calculated levels are elevated.


    Disclosed is as a biomarker useful in early diagnosis of lung cancer, at least one protein selected from the group including Quescin-sulfhydryl oxidase 1, Fibrillin-1, Isoform A of Lamin-A/C, Latent-transforming growth factor beta-binding protein 2, Galectin-1, highly similar to Dickkopf-related protein 3, Isoform Al--B of Heterogeneous nuclear ribonucleoprotein Al, 14-3-3 protein epsilon, Stanniocalcin-2, Cystatin-C, Isoform 1 of Connective tissue growth factor, Profilin-1, Isoform 1 of Extracellular matrix protein 1, Histone H2B type 2-E, Kinesin-like protein KIF26A, Zinc finger protein 516, and Isoform 1 of A-kinase anchor protein 9.


    The present invention provides methods for treating interstitial lung diseases, comprising administering to an individual an effective amount of an inhibitor of coagulation factor XII. The invention further provides uses and pharmaceutical kits for that treatment.


    Methods are provided for protecting against ventilation-induced lung injury both directly, by lowering surface tension, and indirectly, by promoting equitable liquid distribution in pulmonary alveolar edema, in which liquid- and air-filled alveoli are normally interspersed. Since a pressure barrier is responsible for trapping liquid in discrete edematous alveoli and the magnitude of the barrier is proportional to surface tension at the air-liquid interface, the present invention provides various means for promoting equitable redistribution of edema liquid amongst alveoli to help protect the lung during ventilation, including: i) use of an additive that lowers surface tension; ii) use of active, accelerated deflation during mechanical ventilation; and iii) high frequency (>50 Hz) vibration of the lung.


    The present application relates to a method for modulating the growth state of an lung tissue, or a cell thereof, e.g., by ectopically contacting the tissue, in vitro or in vivo, with a hedgehog therapeutic, a ptc therapeutic, or an FGF-10 therapeutic in an amount effective to alter the rate (promote or inhibit) of proliferation of cells in the lung tissue, e.g., relative to the absence of administeration of the hedgehog therapeutic or ptc therapeutic. The subject method can be used, for example, to modulate the growth state of epithelial and/or mesenchymal cells of a lung tissue, such as may be useful as part of a regimen for prevention of a disease state, or in the treatment of an existing disease state or other damage to the lung tissue.


    Disclosed are a method of detecting the presence or absence of a single nucleotide polymorphism of a gene, for prediction of the risk of developing drug-induced lung injury, or for improving a therapeutic method, and a kit for carrying out the detection method. The detection method is characterized by comparing an ABCB1 gene in a biological sample with a wild-type ABCB1 gene to detect the presence or absence of a single nucleotide polymorphism in the ABCB1 gene in the biological sample, in particular, by determining the nucleotide at position 3751 of the CDS of the ABCB1 gene. The kit comprises an oligonucleotide probe which specifically binds to a single nucleotide polymorphism in an ABCB1 gene under selective binding conditions, or an oligonucleotide primer which amplifies a nucleic acid sequence comprising a single nucleotide polymorphism in an ABCB1 gene.


    This invention relates to surgical instruments for applying, energy to tissue. In one embodiment, an elongated introducer has a handle portion that includes an interior chamber that is supplied with a biocompatible liquid under pressure. An energy source causes a liquid-to-vapor phase change within the interior chamber and ejects a flow of vapor media from the working end of the introducer. The flow of vapor is controlled by a computer controller to cause a selected pressure, a selected volume of vapor, and an optional aspiration of vapor condensate. Contemporaneous with tissue contact, the vapor undergoes a vapor-to-liquid phase transition which delivers large amount of energy to the targeted tissue. In one embodiment, the system is configured for volumetric removal of tissue by means of high velocity ejection of a vapor media from a first vapor port proximate to soft tissue wherein the vapor-to-liquid phase change of the media applies energy to the tissue. The system provides a second port coupled to a suction source that cooperates with the first vapor port to suction tissue debris from the targeted site.

  • Method Of Treating Acute Lung Injury Using Sphingosine 1 Phosphate Analogs Or Sphingosine 1 Phosphate Receptor Agonists

    The invention provides methods for treating or reducing the risk of developing acute lung injury manifested by increased vascular permeability. Also provided are pharmaceutical compositions comprising an FTY720 analog or derivative and/or SEW 2871 for use in the disclosed methods. The invention also provides methods for treating or reducing the risk of developing acute lung injury resulting from dysregulation of ceramide/sphingolipid pathway, more specifically, acute lung injury resulting from radiation.


    The present invention regards a method for providing a diagnosis for small cell lung carcinoma and for typical carcinoid tumor by using a panel of protein biomarkers which are differentially expressed and a method for screening compounds.


    In accordance with the invention, a novel gene translocation, (4p15, 6q22), in human non-small cell lung carcinoma (NSCLC) that results in a fusion proteins combining part of Sodium-dependent Phosphate Transporter Isoform NaPi-3b protein (SLC34A2) with Proto-oncogene Tyrosine Protein Kinase ROS Precursor (ROS) kinase has now been identified. The SLC34A2-ROS fusion protein is anticipated to drive the proliferation and survival of a subgroup of NSCLC tumors. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ROS kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of the new fusion protein enables new methods for determining the presence of these mutant ROS kinase polypeptides in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides, which are also provided by the invention.


    SP-B peptoid compounds, lung surfactant compositions and related surfactant replacement therapies. Such SP-B peptoids can mimic lung surfactant protein B, and can be used in conjunction with biomimetic SP-C compounds over a range of lung surfactant compositions.


    The application provides methods of prognosmg, diagnosing, screening and classifying lung cancer patients into poor survival groups or good survival groups. A number of altered genomic regions have been identified that distinguish subtype of lung adenocarcinoma (ADC), specifically between bronchioloalveolar carcinoma (BAC) and invasive ADC with BAC features (AWBF), and genes and biomarkers whose expression are altered in individuals with pulmonary ADC according to different survival outcomes. The amplification and/or deletion of these genomic regions, and/or the biomarker expression profiles can be used to classify patients with ADC into a BAC group with excellent survival outcome, or an invasive ADC with BAC features group with higher risk of developing metastatic recurrence and poorer survival outcome. The application also includes kits for use in the methods of the application.

  • Global Analysis of Serum microRNAs as Potential Biomarkers for Lung Adenocarcinoma

    A diagnostic kit to detect lung adenocarcinoma, or to stratify patients according to expected prognosis comprising at least one oligonucleotide probe capable of binding to at least a portion of a circulating miRNA selected from the group comprising miR-556, -550, -939, -616*, -146b-3p, -30c-1*, -339-5p and -656.


    The present invention provides methods for providing a prognosis for lung cancer using a panel of eleven molecular markers that includes BAG1, BRCA1, CDC6, CDK2AP1, ERBB3, FUT3, IL11, LCK, RND3, SH3BGR, and WNT3A, which are differentially expressed in lung cancer. The eleven markers are related to patient prognosis to 5-year overall survival outcomes, and are particularly useful in providing a prognosis for non-squamous NSCLC.


    Embodiments of the invention relate to human stem cells and their therapeutic use in the treatment and/or prevention of lung diseases. Provided herein are compositions comprising c-kit positive human lung stem cells and methods of preparing and using c-kit positive human lung stem cells for the treatment and/or prevention of lung diseases.


    Brachytherapy treatment of a patient's lung tissue following resection is effected using a balloon applicator which is inserted, normally through the same opening used for the surgery, through the chest wall and into the cavity. The lung and chest openings are closed around the applicator and generally sealed around the applicator. A suction port is provided, in a suction circuit of the applicator, to withdraw fluid from the pleural cavity, at intervals as needed, to assure that the lung can be inflated. Different embodiments of suction circuits are disclosed. A bronchial applicator and method are also disclosed.


    The present disclosure is generally related to pulmonary autoantigens. The disclosure provides methods and kits for assessing whether a subject has or is predisposed to interstitial lung disease. Additionally the present disclosure provides methods of treatment and animal models of interstitial lung disease.


    Apparatus for evaluating a mechanically ventilated patient's hemodynamic status, adapted to provide a respiratory variation diagram of a hemodynamic variable, and being capable of deriving the value of a hemodynamic parameter for each mechanical breath cycle as well as an assessment of its suitability for the hemodynamic analysis on basis of the respiratory variation diagram. A method is also provided.


    Brachytherapy treatment of a patient's lung tissue following resection is effected using a balloon applicator which is inserted, normally through the same opening used for the surgery, through the chest wall and into the cavity. The lung and chest openings are closed around the applicator and generally sealed around the applicator. A suction port is provided, in a suction circuit of the applicator, to withdraw fluid from the pleural cavity, at intervals as needed, to assure that the lung can be inflated. Different embodiments of suction circuits are disclosed. A bronchial applicator and method are also disclosed.


    The present invention relates to an active (immunostimulatory) composition comprising at least one RNA, preferably a mRNA, encoding at least two (preferably different) antigens capable of eliciting an (adaptive) immune response in a mammal. The invention furthermore relates to a vaccine comprising said active (immunostimulatory) composition, and to the use of said active (immunostimulatory) composition (for the preparation of a vaccine) and/or of the vaccine for eliciting an (adaptive) immune response for the treatment of lung cancer, particularly of non-small cell lung cancers (NSCLC), preferably selected from the three main sub-types squamous cell lung carcinoma, adenocarcinoma and large cell lung carcinoma, or of disorders related thereto. Finally, the invention relates to kits, particularly to kits of parts, containing the active (immunostimulatory) composition and/or the vaccine.


    An insulative device including an inner layer configured to contact a wearer's body, an outer layer coupled to the inner layer and configured to face away from the wearer's body, a pad disposed between the inner layer and the outer layer and the pad configured to cover a region of the wearer's torso corresponding approximately to the location of the lungs of the wearer, and wherein the inner layer includes a wicking material and the pad includes a sweat absorbing material so that sweat is wicked away from the body, absorbed in the pad, and prevented from evaporating near the wearer's body keeping the region around the lungs warm while allowing the rest of the wearer's body to stay cool so that symptoms of lung ailments are reduced.


    A method of minimally invasively reducing a volume of a hyper-inflated target section of diseased lung comprising the steps of introducing a bronchoscope into a patient's airway to a position adjacent the target section and equilibrating air within the target section with atmospheric air to at least partially deflate the target lung section; injecting an inflammation-causing substance into the target section to precipitate adhesion of the walls within the target lung section, preventing substantial re-inflation of the target section by occluding an airway upstream of the target section for a period of time, and removing the airway occlusion after the target section has substantially permanently been reduced in volume. The injected substance can be autologous blood or a constituent thereof.


    Methods of lung cancer in a sample from a patient are provided. Methods of detecting changes in expression of one or more target RNAs associated with lung cancer are also provided. Compositions and kits are also provided.


    A ProNGF inhibitor for preparing a drug, said drug being in particular useful for blocking remote dissemination and cell invasion in patients suffering from cancer, in particular breast, thyroid or lung cancer.


    The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-O-methoxyethyl modifications, has nucleotides 5-17 which are 2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.

  • Tissue Engineering of Lung

    The present invention relates to compositions comprising a decellularized tissue. The present invention also provides an engineered three dimensional lung tissue exhibiting characteristics of a natural lung tissue. The engineered tissue is useful for the study of lung developmental biology and pathology as well as drug discovery.


    This invention encompasses methods, pharmaceutical compositions, and kits for modulating (e.g. reducing) the production of pro-inflammatory mediators involved in the pathology of a lung disease, disorder, and/or injury in a patient having the lung disease, disorder, and/or injury. The invention also encompasses methods, pharmaceutical compositions, and kits for inhibiting the production of pro-inflammatory mediators involved in the pathology of a lung disease, disorder, and/or injury in a patient having the lung disease, disorder, and/or injury. In one embodiment, the umbilical cord tissue-derived cells are isolated from human umbilical cord tissue substantially free of blood, are capable of self-renewal and expansion in culture, lack the production of CD117 or CD45, and do not express hTERT or telomerase.

  • microRNA Biomarkers for Human Breast and Lung Cancer

    The present invention relates to novel molecular markers for diagnosis and classification of human breast cancer and lung cancer.


    The present invention relates generally to the use of recombinant human CC10 (rhCC10), also known as recombinant human uteroglobin, for use as a therapeutic in the treatment of Respiratory Distress Syndrome (RDS), Bronchopulmonary dysplasia (BPD), chronic lung disease and/or pulmonary fibrosis, Asthma and Chronic Obstructive Pulmonary Disease (COPD). More particularly, the invention provides methods, including broadly the critical dosage ranges of rhCC10, which may be administered to safely and effectively treat the aforementioned conditions. The invention further provides a composition useful in administering rhCC10 to humans.


    Near-infrared Raman spectroscopy can be applied to identify preneoplastic lesions of the bronchial tree. Real-time in vivo Raman spectra of lung tissues may be obtained with a fiber optic catheter passed down the instrument channel of a bronchoscope. Using prototype apparatus, preneoplastic lesions were detected with sensitivity and specificity of 96 and 91% respectively. The use of Raman spectroscopy apparatus and methods in conjunction with other bronchoscopy imaging modalities can substantially reduce the number of false positive results.


    The present invention relates to synthetic lung surfactant compositions that contain one or more of phospholipase-resistant phospho-glycerol derivatives, phospholipase-resistant phospho-choline derivatives, and surface active proteins or peptides, more preferably a combination of at least two or all three of these materials. Novel phospholipase-resistant phospho-glycerol derivatives, phospholipase-resistant phospho-choline derivatives, and surface active peptides are also disclosed herein. Uses of the surfactant compositions of the present invention to treat endogenous surfactant dysfunctional or deficient lung tissue, to prepare synthetic peptides for use in the surfactant compositions, and to deliver therapeutic agents are also disclosed.


    The present invention regards a novel administration form and a novel administration regime useful in the treatment and prevention of a bacterial lung infection in patient in need thereof, in particular by providing a composition useful for aerosolization of a highly concentrated solution of aminoglycosides such as Tobramycin.


    Operation of a patient's lungs may be analyzed by transmitting ultrasound energy into the patient's lung, and obtain power and velocity Doppler data while a vibration is being induced in the lung. At least one portion of the power and velocity data that corresponds to a fundamental harmonic is then identified. In some embodiments, portions of the power and velocity data that corresponds to higher order harmonics are also identified. The power observed in the fundamental harmonic and optionally the higher order harmonics can then be used to determine the condition of the lungs.

  • Treatment and prevention of diffuse parenchymal lung disease by selective active-site mTOR inhibitors

    Provided herein are methods for treating or preventing pulmonary fibrosis in subjects suffering from diffuse parenchymal lung diseases using selective active-site mTOR inhibitors.


    Systems and devices for minimally invasively treating an air leak in a lung comprise the steps of detecting an air leak in a lung; locating an airway in fluid communication with the air leak, introducing a bronchoscope into a patient's airway to a position adjacent the target section and occluding an airway upstream of the air leak for a period of time. The airway occlusion device is preferably removed after the air leak has substantially permanently healed. The occluding device may be a one-way valve. The occluding device may also comprise strut members and anchors that penetrate an airway wall.


    Medical methods and systems are provided for effecting lung volume reduction by selectively ablating segments of lung tissue.


    The present invention describes methods for using Treprostinil or its derivative, or a pharmaceutically acceptable salt thereof, for the treatment and/or prevention of interstitial lung disease or asthma, or a condition, such as pulmonary fibrosis, associated with interstitial lung disease or a condition associated with asthma. The invention also relates to kits for treatment and/or prevention of such condition that include an effective amount of Treprostinil or its derivative, or a pharmaceutically acceptable salt thereof.


    Disclosed herein are therapeutic methods for treating lung diseases, disorders and injury in a mammal, including treatment of acute respiratory distress syndrome (ARDS), acute lung injury, pulmonary fibrosis (idiopathic), bleomycin induced pulmonary fibrosis, mechanical ventilator induced lung injury, chronic obstructive pulmonary disease (COPD), chronic bronchitis, emphysema, bronchiolitis obliterans after lung transplantation and lung transplantation-induced acute graft dysfunction, including treatment, prevention or prevention of progression of primary graft failure, ischemia-reperfusion injury, reperfusion injury, reperfusion edema, allograft dysfunction, pulmonary reimplantation response, bronchiolitis obliterans after lung transplantation and/or primary graft dysfunction (PGD) after organ transplantation, in particular in lung transplantation, comprising downregulating the TLR2 gene or both the TLR2 gene and TLR4 gene. Provided herein are compositions, methods and kits for treating lung diseases, disorders and injury.